WormBase Tree Display for Expr_pattern: Expr6548
expand all nodes | collapse all nodes | view schema
Expr6548 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | R155:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005733 | |||||
WBbt:0005738 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0005813 | |||||
Type | Reporter_gene | [R155.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGAAATGAAATGCGAAAGGTAG] 3' and primer B 5' [TCCGACTACGCCGATTGT] 3'. | |||
Pattern | Adult Expression: pharynx; intestine; body wall muscle; hypodermis; unidentified cells in body ;unidentified cells in tail ; | ||||
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; | |||||
Picture | WBPicture0000006142 | ||||
Remark | Also expressed in (comments from author) : Unidentified cells in tail and reproductive system.Strain not available. | ||||
Strain: BC11678 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002233 |