WormBase Tree Display for Expr_pattern: Expr6548
expand all nodes | collapse all nodes | view schema
| Expr6548 | Expression_of | Gene | WBGene00020115 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00020115 | ||
| Homol | Homol_homol | R155:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [R155.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGAAATGAAATGCGAAAGGTAG] 3' and primer B 5' [TCCGACTACGCCGATTGT] 3'. | |
| Pattern | Adult Expression: pharynx; intestine; body wall muscle; hypodermis; unidentified cells in body ;unidentified cells in tail ; | ||
| Larval Expression: pharynx; intestine; body wall muscle; hypodermis; | |||
| Picture | WBPicture0000006142 | ||
| Remark | Also expressed in (comments from author) : Unidentified cells in tail and reproductive system.Strain not available. | ||
| Strain: BC11678 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002233 |
