Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6506

expand all nodes | collapse all nodes | view schema

Name Class

Expr6506Expression_of (2)
HomolHomol_homolR11D1:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[rpl-28::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCCCTTCCCCCTATCTT] 3' and primer B 5' [CGTCGGAGATTTTACCTGGA] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; spermatheca; body wall muscle; excretory gland cells; Nervous System; head neurons; tail neurons;
Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; developing uterus; body wall muscle; excretory gland cells; Nervous System; head neurons; tail neurons;
RemarkAlso expressed in (comments from author) : Note: primers are incorrect.
Strain: BC15433
ReferenceWBPaper00006525
TransgeneWBTransgene00003964