WormBase Tree Display for Expr_pattern: Expr6503
expand all nodes | collapse all nodes | view schema
Expr6503 | Expression_of | Gene | WBGene00011240 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00011240 | ||||
Homol | Homol_homol | R11A8:Expr | |||
Expression_data | Life_stage | WBls:0000023 | |||
Anatomy_term | WBbt:0003679 | ||||
WBbt:0003681 | |||||
WBbt:0003929 | |||||
WBbt:0003931 | |||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005753 | |||||
WBbt:0005772 | |||||
WBbt:0005800 | |||||
WBbt:0006748 | |||||
WBbt:0006751 | |||||
Type | Reporter_gene | [R11A8.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGTTTTTCTCATATTTGTTTCT] 3' and primer B 5' [TTTCTAATGGAATGAGGTGATTGA] 3'. | |||
Pattern | Larval Expression: pharynx; intestine; rectal epithelium; developing vulva; hypodermis; seam cells; Nervous System; head neurons; amphid socket cells; neurons along body; unidentified cells in head; | ||||
Remark | Also expressed in (comments from author) : Embryo and adult incomplete. To be updated. | ||||
Strain: BC14319 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004573 |