WormBase Tree Display for Expr_pattern: Expr6490
expand all nodes | collapse all nodes | view schema
Expr6490 | Expression_of | Gene | WBGene00019983 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00019983 | ||
Homol | Homol_homol | R09E12:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [R09E12.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGTAGATCACAACGATATGGG] 3' and primer B 5' [TACGGCGTCCGTCATTTT] 3'. | |
Pattern | Adult Expression: pharynx; intestine; Nervous System; head neurons; tail neurons; unidentified cells in body ;unidentified cells in tail ; | ||
Larval Expression: pharynx; intestine; body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in body ;unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC11304 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002548 |