Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6490

expand all nodes | collapse all nodes | view schema

Name Class

Expr6490Expression_ofGeneWBGene00019983
Reflects_endogenous_expression_ofWBGene00019983
HomolHomol_homolR09E12:Expr
Expression_data (2)
TypeReporter_gene[R09E12.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGTAGATCACAACGATATGGG] 3' and primer B 5' [TACGGCGTCCGTCATTTT] 3'.
PatternAdult Expression: pharynx; intestine; Nervous System; head neurons; tail neurons; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: pharynx; intestine; body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in body ;unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC11304
ReferenceWBPaper00006525
TransgeneWBTransgene00002548