Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6479

expand all nodes | collapse all nodes | view schema

Name Class

Expr6479Expression_of (2)
HomolHomol_homolR07E5:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[R07E5.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCACATGAGATTTTGCATGG] 3' and primer B 5' [GAGTATCGCTGATTCTGGAAAGAT] 3'.
PatternAdult Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; unidentified cells;
Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; body wall muscle; hypodermis; excretory cell; unidentified cells;
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC12438
ReferenceWBPaper00006525
TransgeneWBTransgene00002927