WormBase Tree Display for Expr_pattern: Expr6454
expand all nodes | collapse all nodes | view schema
Expr6454 | Expression_of | Gene | WBGene00005114 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00005114 | ||||
Homol | Homol_homol | R04D3:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005735 | ||||
WBbt:0005772 | Partial | ||||
Remark | ant and post cells | ||||
WBbt:0006751 | |||||
Type | Reporter_gene | [srd-36::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGAAATGTGGACGTATGGA] 3' and primer B 5' [ACCAAAGGGCGTGTAGTTTCT] 3'. | |||
Pattern (2) | |||||
Remark | Strain: BC15859 | ||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004110 |