WormBase Tree Display for Expr_pattern: Expr6402
expand all nodes | collapse all nodes | view schema
| Expr6402 | Expression_of (2) | ||
|---|---|---|---|
| Homol | Homol_homol | M01E11:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003822 | ||
| WBbt:0003833 | |||
| WBbt:0004292 | |||
| WBbt:0005747 | |||
| WBbt:0005813 | |||
| WBbt:0005821 | |||
| Type | Reporter_gene | [M01E11.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGGGACCGATGGTTTTAG] 3' and primer B 5' [AACCGGGATCTCCTCTTCTT] 3'. | |
| Pattern | Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; | ||
| Larval Expression: anal depressor muscle; body wall muscle; | |||
| Picture | WBPicture0000009118 | ||
| WBPicture0000009119 | |||
| WBPicture0000009120 | |||
| WBPicture0000009121 | |||
| Remark | Also expressed in (comments from author) : high intensity GFP interferes with tissue identification.Mosaic population. | ||
| Strain: BC10244 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002153 |
