WormBase Tree Display for Expr_pattern: Expr6402
expand all nodes | collapse all nodes | view schema
Expr6402 | Expression_of | Gene | WBGene00006508 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006508 | ||
Homol | Homol_homol | M01E11:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003822 | ||
WBbt:0003833 | |||
WBbt:0004292 | |||
WBbt:0005747 | |||
WBbt:0005813 | |||
WBbt:0005821 | |||
Type | Reporter_gene | [M01E11.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGGGACCGATGGTTTTAG] 3' and primer B 5' [AACCGGGATCTCCTCTTCTT] 3'. | |
Pattern | Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; | ||
Larval Expression: anal depressor muscle; body wall muscle; | |||
Picture | WBPicture0000009118 | ||
WBPicture0000009119 | |||
WBPicture0000009120 | |||
WBPicture0000009121 | |||
Remark | Also expressed in (comments from author) : high intensity GFP interferes with tissue identification.Mosaic population. | ||
Strain: BC10244 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002153 |