Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6399

expand all nodes | collapse all nodes | view schema

Name Class

Expr6399Expression_ofGeneWBGene00019693
Reflects_endogenous_expression_ofWBGene00019693
HomolHomol_homolM01A10:Expr
Expression_data (2)
TypeReporter_gene[M01A10.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACATCTGGACGATCTGTTGTTG] 3' and primer B 5' [CCTTGAAAATCGGAAAAATTAGAA] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons;
RemarkAlso expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated.
Strain: BC11601
ReferenceWBPaper00006525
TransgeneWBTransgene00002631