WormBase Tree Display for Expr_pattern: Expr6399
expand all nodes | collapse all nodes | view schema
Expr6399 | Expression_of | Gene | WBGene00019693 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00019693 | ||
Homol | Homol_homol | M01A10:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [M01A10.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACATCTGGACGATCTGTTGTTG] 3' and primer B 5' [CCTTGAAAATCGGAAAAATTAGAA] 3'. | |
Pattern | Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; | ||
Larval Expression: pharynx; intestine; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; | |||
Remark | Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated. | ||
Strain: BC11601 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002631 |