WormBase Tree Display for Expr_pattern: Expr6286
expand all nodes | collapse all nodes | view schema
Expr6286 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | Y34B4A:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
Anatomy_term | WBbt:0003681 | ||
WBbt:0005772 | |||
WBbt:0005813 | |||
Type | Reporter_gene | [mtm-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCACATGAAAAAGCAAAGCTC] 3' and primer B 5' [TCGGATGATCTTTCTGTCGAG] 3'. | |
Pattern | Adult Expression: pharynx; intestine; body wall muscle; | ||
Remark | Also expressed in (comments from author) : incomplete. Will be updated. | ||
Strain: BC11736 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002679 |