Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6272

expand all nodes | collapse all nodes | view schema

Name Class

Expr6272Expression_ofGeneWBGene00019162
Reflects_endogenous_expression_ofWBGene00019162
HomolHomol_homolH06H21:Expr
Expression_data (2)
TypeReporter_gene[H06H21.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACTCTCTCCACCTGCATCTC] 3' and primer B 5' [CTTCGGGATTGCTGAAAATATTAC] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; Reproductive System; developing vulva; developing spermatheca; body wall muscle; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC14510
ReferenceWBPaper00006525
TransgeneWBTransgene00003583