WormBase Tree Display for Expr_pattern: Expr6260
expand all nodes | collapse all nodes | view schema
Expr6260 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | F59A6:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
Anatomy_term | WBbt:0005733 | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
Type | Reporter_gene | [nsy-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCTCACCGACAGTTTAAG] 3' and primer B 5' [CTGCGAGATTTTCTTTTGATTCTT] 3'. | |||
Pattern | Adult Expression: intestine; hypodermis; unidentified cells in head; unidentified cells in tail ; | ||||
Picture | WBPicture0000005639 | ||||
WBPicture0000005640 | |||||
WBPicture0000005641 | |||||
Remark | Also expressed in (comments from author) : Notes were not entered into database, and images are only for adult. Have extrapolated data from the images, but this leaves the analysis incomplete. Unidentified head/tail GFP may be neural. | ||||
Strain: BC10545 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002304 |