WormBase Tree Display for Expr_pattern: Expr6165
expand all nodes | collapse all nodes | view schema
Expr6165 | Expression_of | Gene | WBGene00018788 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00018788 | ||
Homol | Homol_homol | F54A5:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [F54A5.3A::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGGATAACCTCCCGGAAAT] 3' and primer B 5' [CGCCGCAAGTTGATTTTT] 3'. | |
Pattern | Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; Nervous System; nerve ring; head neurons; tail neurons; | ||
Larval Expression: pharynx; intestine; Nervous System; nerve ring; head neurons; tail neurons; | |||
Picture | WBPicture0000009353 | ||
WBPicture0000009354 | |||
WBPicture0000009355 | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC10853 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004324 |