WormBase Tree Display for Expr_pattern: Expr6159
expand all nodes | collapse all nodes | view schema
Expr6159 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | F53F10:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005739 | Partial | |||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
Type | Reporter_gene | [npp-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGGGAACCTGAAGCAAAAT] 3' and primer B 5' [GGTGCAGATCCTCCAAAGAT] 3'. | |||
Pattern | Adult Expression: intestine; unidentified cells in head; | ||||
Larval Expression: intestine; unidentified cells in head; | |||||
Remark | Also expressed in (comments from author) : There may be neural expression in the head. | ||||
Strain: BC12662 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002989 |