Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6108

expand all nodes | collapse all nodes | view schema

Name Class

Expr6108Expression_ofGeneWBGene00009829
Reflects_endogenous_expression_ofWBGene00009829
HomolHomol_homolF47G9:Expr
Expression_data (2)
TypeReporter_gene[F47G9.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTAACCCGATTTCGCCAC] 3' and primer B 5' [CTAGAGATTTGATAATTGTTCGGA] 3'.
PatternAdult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; distal tip cell; vulval muscle; body wall muscle; seam cells; Nervous System; head neurons; neurons along body;
Larval Expression: pharynx; anal depressor muscle; body wall muscle; seam cells; Nervous System; head neurons; neurons along body;
RemarkStrain: BC15540
ReferenceWBPaper00006525
TransgeneWBTransgene00004010