Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6093

expand all nodes | collapse all nodes | view schema

Name Class

Expr6093Expression_ofGeneWBGene00004801
Reflects_endogenous_expression_ofWBGene00004801
HomolHomol_homolF46G10:Expr
Expression_data (2)
TypeReporter_gene[sir-2.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCTTTTTAATGGATTTTCG] 3' and primer B 5' [CAAACTTTTGAGCGATGCCTA] 3'.
PatternAdult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; spermatheca; gonad sheath cells; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in body ;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in body ;
RemarkStrain: BC14289
ReferenceWBPaper00006525
TransgeneWBTransgene00003488