WormBase Tree Display for Expr_pattern: Expr6034
expand all nodes | collapse all nodes | view schema
| Expr6034 | Expression_of | Gene | WBGene00018304 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00018304 | ||
| Homol | Homol_homol | T13C2:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [F41G3.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGAACAGTGTTGTTTTTGTTGGT] 3' and primer B 5' [CATGTGAAAGTGAAAATGTTTCGT] 3'. | |
| Pattern | Adult Expression: intestine; Nervous System; head neurons; amphids; unidentified cells; | ||
| Larval Expression: intestine; Nervous System; head neurons; amphids; unidentified cells; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC11131 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002502 |
