WormBase Tree Display for Expr_pattern: Expr6016
expand all nodes | collapse all nodes | view schema
Expr6016 | Expression_of | Gene | WBGene00009583 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00009583 | ||
Homol | Homol_homol | F40F9:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [F40F9.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGCCGGATACTGACGG] 3' and primer B 5' [TGATTACTGGAATCGAAGGTTTG] 3'. | |
Pattern | Adult Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; rectal epithelium; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | ||
Larval Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; rectal epithelium; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |||
Picture | WBPicture0000005155 | ||
WBPicture0000005156 | |||
Remark | Also expressed in (comments from author) : ubiquitous in embryo and freshly hatched L1s | ||
Strain: BC12513 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004376 |