WormBase Tree Display for Expr_pattern: Expr6009
expand all nodes | collapse all nodes | view schema
Expr6009 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | F40F11:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (20) | |||
Type | Reporter_gene | [F40F11.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCGCCATTAAGAAGTACAGTAAC] 3' and primer B 5' [TTGTTTCCGAATCATTATCTTGTT] 3'. | |
Pattern | Adult Expression: pharynx; anal depressor muscle; Reproductive System; uterus; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; unidentified cells in head; unidentified cells in tail ; | |||
Picture | WBPicture0000005158 | ||
WBPicture0000005159 | |||
WBPicture0000005160 | |||
WBPicture0000005161 | |||
WBPicture0000005162 | |||
WBPicture0000005163 | |||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail, a lot of neural | ||
Strain: BC12753 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004468 |