Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5996

expand all nodes | collapse all nodes | view schema

Name Class

Expr5996Expression_ofGeneWBGene00018187
Reflects_endogenous_expression_ofWBGene00018187
HomolHomol_homolF38E9:Expr
Expression_data (2)
TypeReporter_gene[F38E9.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACCCCAAATTTGAAGCAAAC] 3' and primer B 5' [AGTTTGGCACGCCATAGTAGTAG] 3'.
PatternAdult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; vulval muscle; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons;
RemarkStrain: BC14271
ReferenceWBPaper00006525
TransgeneWBTransgene00003476