WormBase Tree Display for Expr_pattern: Expr5984
expand all nodes | collapse all nodes | view schema
| Expr5984 | Expression_of | Gene | WBGene00009514 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00009514 | ||
| Homol | Homol_homol | F37H8:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [F37H8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGTGTTGTGCACTTTTCCC] 3' and primer B 5' [ATGGTTGTGCTGATGTTAGGG] 3'. | |
| Pattern | Adult Expression: intestine; Reproductive System; vulva other; gonad sheath cells; Nervous System; head neurons; | ||
| Larval Expression: intestine; rectal gland cells; Reproductive System; developing vulva; gonad sheath cells; Nervous System; head neurons; | |||
| Picture | WBPicture0000005116 | ||
| WBPicture0000005117 | |||
| WBPicture0000005118 | |||
| WBPicture0000005119 | |||
| WBPicture0000005120 | |||
| Remark | Also expressed in (comments from author) : Second analysis, 5months later, showed reduced tissue expression (lost gonad sheath cells, developing vulva, and rectal gland cells) | ||
| Strain: BC13660 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003242 |
