WormBase Tree Display for Expr_pattern: Expr5944
expand all nodes | collapse all nodes | view schema
| Expr5944 | Expression_of | Gene | WBGene00009367 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00009367 | ||
| Homol | Homol_homol | F33H2:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (29) | |||
| Type | Reporter_gene | [F33H2.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACATAATCGATAGACTCCCAGC] 3' and primer B 5' [TAGACGGGATGATTGAGGATG] 3'. | |
| Pattern (2) | |||
| Picture | WBPicture0000005052 | ||
| WBPicture0000005053 | |||
| WBPicture0000005054 | |||
| WBPicture0000005055 | |||
| WBPicture0000005056 | |||
| WBPicture0000005057 | |||
| WBPicture0000005058 | |||
| Remark | Also expressed in (comments from author) : Mosaic population.Hypodermis: only in the tail.Coelomocytes: saw the 4 ventral cells. | ||
| Strain: BC14222 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003451 |
