WormBase Tree Display for Expr_pattern: Expr5929
expand all nodes | collapse all nodes | view schema
Expr5929 | Expression_of | Gene | WBGene00000092 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000092 | ||||
Homol | Homol_homol | F32A6:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
Type | Reporter_gene | [F32A6.4a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGTTCGACATCTTAAGGATACA] 3' and primer B 5' [GTCCTGGATCGCACCTTT] 3'. | |||
Pattern | Adult Expression: pharynx; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: pharynx; intestine; unidentified cells in head; unidentified cells in tail ; | |||||
Picture | WBPicture0000005026 | ||||
WBPicture0000005027 | |||||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail, possibly neural | ||||
Strain: BC10674 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002080 |