Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5928

expand all nodes | collapse all nodes | view schema

Name Class

Expr5928Expression_of (2)
HomolHomol_homolF32A6:Expr
Expression_data (2)
TypeReporter_gene[F32A6.4a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGTTCGACATCTTAAGGATACA] 3' and primer B 5' [GTCCTGGATCGCACCTTT] 3'.
Pattern (2)
RemarkStrain: BC10107
ReferenceWBPaper00006525
TransgeneWBTransgene00002080