WormBase Tree Display for Expr_pattern: Expr5918
expand all nodes | collapse all nodes | view schema
Expr5918 | Expression_of | Gene | WBGene00006062 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006062 | ||
Homol | Homol_homol | F30A10:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [stn-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCTTGTCTCTCGCTCAATACA] 3' and primer B 5' [GCCGATCTAATCGGAGCA] 3'. | |
Pattern | Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; tail neurons; | ||
Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; tail neurons; | |||
Picture | WBPicture0000005013 | ||
WBPicture0000005014 | |||
WBPicture0000005015 | |||
WBPicture0000005016 | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product.Mosaic population. | ||
Strain: BC14057 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003386 |