WormBase Tree Display for Expr_pattern: Expr5910
expand all nodes | collapse all nodes | view schema
Expr5910 | Expression_of | Gene | WBGene00006446 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006446 | ||||
Homol | Homol_homol | F28F8:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005319 | |||||
WBbt:0005733 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005753 | |||||
WBbt:0005772 | |||||
WBbt:0005813 | |||||
WBbt:0006748 | |||||
Type | Reporter_gene | [atx-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGATGCAAAAATAAACCATTCG] 3' and primer B 5' [TTGGAGCTGGAAAAATTTGG] 3'. | |||
Pattern | Adult Expression: pharynx; intestine; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; unidentified cells in head; | ||||
Larval Expression: pharynx; intestine; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; unidentified cells in head; | |||||
Picture | WBPicture0000004986 | ||||
Remark | Also expressed in (comments from author) : Very mosaic strain, with low intensity GFP. | ||||
Strain: BC11021 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002450 |