WormBase Tree Display for Expr_pattern: Expr5878
expand all nodes | collapse all nodes | view schema
| Expr5878 | Expression_of | Gene | WBGene00004400 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00004400 | ||
| Homol | Homol_homol | F26F4:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [rom-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCAATCACATCCGATAGTTTC] 3' and primer B 5' [AAAGATGTTGTGGAGAAGGAGAAC] 3'. | |
| Pattern | Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; Reproductive System; vulval muscle; Nervous System; head neurons; unidentified cells; | ||
| Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC12501 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002953 |
