Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5878

expand all nodes | collapse all nodes | view schema

Name Class

Expr5878Expression_ofGeneWBGene00004400
Reflects_endogenous_expression_ofWBGene00004400
HomolHomol_homolF26F4:Expr
Expression_data (2)
TypeReporter_gene[rom-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCAATCACATCCGATAGTTTC] 3' and primer B 5' [AAAGATGTTGTGGAGAAGGAGAAC] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; Reproductive System; vulval muscle; Nervous System; head neurons; unidentified cells;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; Nervous System; head neurons;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC12501
ReferenceWBPaper00006525
TransgeneWBTransgene00002953