WormBase Tree Display for Expr_pattern: Expr5872

Expr5872 Expression_of: Gene: WBGene00017806
    Reflects_endogenous_expression_of: WBGene00017806
  Homol: Homol_homol: F26A1:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0005733
      WBbt:0005738 Partial
        Remark: unidentified cells
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0005753
      WBbt:0005767
      WBbt:0005772 Partial
        Remark: ant and post cells
      WBbt:0005788
  Type: Reporter_gene: [F26A1.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAGAAGGACTGGTTTGTGATTG] 3' and primer B 5' [GATCGAGGCGATTTTCAGAC] 3'.
  Pattern: Adult Expression: pharyngeal gland cells; pharyngeal-intestinal valve; intestine - ant and post cells; hypodermis; unidentified cells in head; unidentified cells in tail ;
    Larval Expression: pharyngeal gland cells; pharyngeal-intestinal valve; intestine - ant and post cells; hypodermis; seam cells; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
  Picture: WBPicture0000004918
    WBPicture0000004919
    WBPicture0000004920
    WBPicture0000009268
  Remark: Also expressed in (comments from author) : unidentified tissue in body, is part of the developing reproductive system
    Strain: BC12751
  Reference: WBPaper00006525
  Transgene: WBTransgene00004480