WormBase Tree Display for Expr_pattern: Expr5867
expand all nodes | collapse all nodes | view schema
Expr5867 | Expression_of | Gene | WBGene00017808 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00017808 | ||||
Homol | Homol_homol | F26A1:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005300 | ||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0006750 | |||||
Type | Reporter_gene | [F26A1.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTCTTGACATACAAGCGAGACTG] 3' and primer B 5' [TTGTCAGCGATTTCTTCTTCTTC] 3'. | |||
Pattern (2) | |||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||||
Strain: BC12386 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002911 |