Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5867

expand all nodes | collapse all nodes | view schema

Name Class

Expr5867Expression_ofGeneWBGene00017808
Reflects_endogenous_expression_ofWBGene00017808
HomolHomol_homolF26A1:Expr
Expression_data (2)
TypeReporter_gene[F26A1.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTCTTGACATACAAGCGAGACTG] 3' and primer B 5' [TTGTCAGCGATTTCTTCTTCTTC] 3'.
PatternAdult Expression: Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head;
Larval Expression: intestine; Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC12386
ReferenceWBPaper00006525
TransgeneWBTransgene00002911