WormBase Tree Display for Expr_pattern: Expr5867
expand all nodes | collapse all nodes | view schema
Expr5867 | Expression_of | Gene | WBGene00017808 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00017808 | ||
Homol | Homol_homol | F26A1:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [F26A1.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTCTTGACATACAAGCGAGACTG] 3' and primer B 5' [TTGTCAGCGATTTCTTCTTCTTC] 3'. | |
Pattern | Adult Expression: Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head; | ||
Larval Expression: intestine; Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC12386 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002911 |