WormBase Tree Display for Expr_pattern: Expr5863
expand all nodes | collapse all nodes | view schema
Expr5863 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | F25H2:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (13) | |||
Type | Reporter_gene | [F25H2.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCTCGTTTCTGCGAATTTTATTT] 3' and primer B 5' [TCAGTGTTGCTGATTTTCGG] 3'. | |
Pattern | Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons; | ||
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons; | |||
Picture | WBPicture0000004906 | ||
Remark | Also expressed in (comments from author) : mosaic population.L1s are mainly intestinal and hypodermal expression. Later stages express GFP in other tissues. | ||
Strain: BC12969 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004509 |