Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5863

expand all nodes | collapse all nodes | view schema

Name Class

Expr5863Expression_of (2)
HomolHomol_homolF25H2:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (13)
TypeReporter_gene[F25H2.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCTCGTTTCTGCGAATTTTATTT] 3' and primer B 5' [TCAGTGTTGCTGATTTTCGG] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons;
PictureWBPicture0000004906
RemarkAlso expressed in (comments from author) : mosaic population.L1s are mainly intestinal and hypodermal expression. Later stages express GFP in other tissues.
Strain: BC12969
ReferenceWBPaper00006525
TransgeneWBTransgene00004509