Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5848

expand all nodes | collapse all nodes | view schema

Name Class

Expr5848Expression_of (2)
HomolHomol_homolF25B4:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (13)
TypeReporter_gene[F25B4.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCTGAAACGTCGGAGATAATAC] 3' and primer B 5' [CATCCACGATTAATCTGAAACTCA] 3'.
PatternAdult Expression: intestine; stomato-intestinal muscle; Reproductive System; vulva other; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkAlso expressed in (comments from author) : high intensity GFP
Strain: BC13667
ReferenceWBPaper00006525
TransgeneWBTransgene00004563