Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5824

expand all nodes | collapse all nodes | view schema

Name Class

Expr5824Expression_of (2)
HomolHomol_homolF22D6:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (13)
TypeReporter_gene[F22D6.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCCACGTGTACACCACACC] 3' and primer B 5' [TCTCGATTGGTGGACCTGA] 3'.
PatternAdult Expression: intestine; Reproductive System; vulval muscle; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons;
Larval Expression: intestine; Reproductive System; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons;
RemarkStrain: BC13596
ReferenceWBPaper00006525
TransgeneWBTransgene00003220