WormBase Tree Display for Expr_pattern: Expr5690
expand all nodes | collapse all nodes | view schema
Expr5690 | Expression_of | Gene | WBGene00001918 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001918 | ||
Homol | Homol_homol | F08G2:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005733 | ||
WBbt:0005753 | |||
WBbt:0005772 | |||
Type | Reporter_gene | [his-44::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATCTCAAAATCTAACCGAACCC] 3' and primer B 5' [ATGTTGAGAGTTGGTGACTTGAAA] 3'. | |
Pattern (2) | |||
Picture | WBPicture0000004633 | ||
WBPicture0000004634 | |||
WBPicture0000004635 | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. | ||
Strain: BC12120 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002827 |