WormBase Tree Display for Expr_pattern: Expr5681
expand all nodes | collapse all nodes | view schema
Expr5681 | Expression_of | Gene | WBGene00006649 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006649 | ||
Homol | Homol_homol | F08F1:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005735 | ||
WBbt:0005772 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [F08F1.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACATGTTCACCCAGAAAA] 3' and primer B 5' [GCGAGTTTTGGAGGAAAGTG] 3'. | |
Pattern (2) | |||
Remark | Authors indicate the expression pattern was for tag-123, but actual primer shows that the experiment is for tth-1. --wjc | ||
Strain: BC10520 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002293 |