WormBase Tree Display for Expr_pattern: Expr5670
expand all nodes | collapse all nodes | view schema
Expr5670 | Expression_of | Gene | WBGene00006166 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006166 | ||
Homol | Homol_homol | F54D1:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005772 | ||
Type | Reporter_gene | [str-115::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGATTGAATAACTTTTTATGACCA] 3' and primer B 5' [TGAATTTTTGTTCTTCTATACGTGA] 3'. | |
Pattern (2) | |||
Picture | WBPicture0000004591 | ||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 3 products. Can predict correct product. | ||
Strain: BC16203 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004196 |