Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5651

expand all nodes | collapse all nodes | view schema

Name Class

Expr5651Expression_ofGeneWBGene00017152
Reflects_endogenous_expression_ofWBGene00017152
Expression_data (2)
TypeReporter_gene[EGAP798.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCATCGCTATCTTTCACCC] 3' and primer B 5' [TCGTCTGGATCCCCGATA] 3'.
PatternAdult Expression: intestine; rectal gland cells; Nervous System; head neurons;
Larval Expression: intestine; rectal gland cells; Nervous System; head neurons;
RemarkAlso expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product.
Strain: BC15659
ReferenceWBPaper00006525
TransgeneWBTransgene00004050