WormBase Tree Display for Expr_pattern: Expr5651
expand all nodes | collapse all nodes | view schema
Expr5651 | Expression_of | Gene | WBGene00017152 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00017152 | ||
Expression_data (2) | |||
Type | Reporter_gene | [EGAP798.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCATCGCTATCTTTCACCC] 3' and primer B 5' [TCGTCTGGATCCCCGATA] 3'. | |
Pattern | Adult Expression: intestine; rectal gland cells; Nervous System; head neurons; | ||
Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. | ||
Strain: BC15659 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004050 |