WormBase Tree Display for Expr_pattern: Expr5641
expand all nodes | collapse all nodes | view schema
| Expr5641 | Expression_of | Gene | WBGene00005938 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00005938 | ||
| Homol | Homol_homol | E02C12:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [srx-47::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTCAATTAGCTTGACACGAAA] 3' and primer B 5' [TCAATCAACGCGTATATAACCTG] 3'. | |
| Pattern | Adult Expression: intestine - posterior cells; Nervous System; head neurons; amphids; unidentified cells in tail ; | ||
| Larval Expression: intestine - posterior cells; Nervous System; head neurons; amphids; unidentified cells in tail ; | |||
| Picture | WBPicture0000004451 | ||
| Remark | Also expressed in (comments from author) : ASH amphid neuron; Also expression in a non-DiI stained, non-ASE/AWC head neuron pair sending dendrite to tip of nose (Hobert Lab 2005). | ||
| Strain: BC13449 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003173 |
