WormBase Tree Display for Expr_pattern: Expr5633
expand all nodes | collapse all nodes | view schema
Expr5633 | Expression_of | Gene | WBGene00004207 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004207 | ||
Homol | Homol_homol | D2089:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [ptb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCGAAAATTGCCTCAGAA] 3' and primer B 5' [ATGCTCACCTTGGTGATGTG] 3'. | |
Pattern | Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterus; vulval muscle; spermatheca; head mesodermal cell; unidentified cells in head; | ||
Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing uterus; developing spermatheca; head mesodermal cell; unidentified cells in head; unidentified cells in tail ; | |||
Picture | WBPicture0000009260 | ||
WBPicture0000009261 | |||
Remark | Also expressed in (comments from author) : the pharyngeal bulbs express but not the isthmus | ||
Strain: BC11352 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004256 |