Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5632

expand all nodes | collapse all nodes | view schema

Name Class

Expr5632Expression_of (2)
HomolHomol_homolD2089:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[ptb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCGAAAATTGCCTCAGAA] 3' and primer B 5' [ATGCTCACCTTGGTGATGTG] 3'.
PatternAdult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; anal sphincter; Reproductive System; uterine muscle; vulval muscle; spermatheca; head mesodermal cell;
Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; anal sphincter; head mesodermal cell; Nervous System; head neurons;
RemarkStrain: BC10287
ReferenceWBPaper00006525
TransgeneWBTransgene00002174