Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5628

expand all nodes | collapse all nodes | view schema

Name Class

Expr5628Expression_ofGeneWBGene00008419
Reflects_endogenous_expression_ofWBGene00008419
HomolHomol_homolD2030:Expr
Expression_data (2)
TypeReporter_gene[D2030.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTCCCGTTCAAACTGAACAA] 3' and primer B 5' [TTCGAGCATAGGGCGAAG] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in body ;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in body ;
RemarkAlso expressed in (comments from author) : unidentified cells near vulva.
Strain: BC11362
ReferenceWBPaper00006525
TransgeneWBTransgene00002441