WormBase Tree Display for Expr_pattern: Expr5616
expand all nodes | collapse all nodes | view schema
Expr5616 | Expression_of | Gene | WBGene00006844 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006844 | ||
Homol | Homol_homol | D1081:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (4) | |||
Type | Reporter_gene | [unc-120::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGTAATAGAGCCCCGTGC] 3' and primer B 5' [TCGGTGATGTTCTGAAATTTTG] 3'. | |
Pattern | Adult Expression: stomato-intestinal muscle; anal depressor muscle; body wall muscle; | ||
Larval Expression: stomato-intestinal muscle; anal depressor muscle; body wall muscle; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC12239 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002877 |