Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5597

expand all nodes | collapse all nodes | view schema

Name Class

Expr5597Expression_ofGeneWBGene00016961
Reflects_endogenous_expression_ofWBGene00016961
HomolHomol_homolC56C10:Expr
Expression_data (2)
TypeReporter_gene[C56C10.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAACGTTTTTCTCTATTTGGTGA] 3' and primer B 5' [TGCCGAACAGGCTGATTT] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkAlso expressed in (comments from author) : No comment.
Strain: BC11002
ReferenceWBPaper00006525
TransgeneWBTransgene00002440