WormBase Tree Display for Expr_pattern: Expr5518
expand all nodes | collapse all nodes | view schema
Expr5518 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | R12G8:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003681 | ||
WBbt:0005772 | |||
Type | Reporter_gene | [pgp-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAAAACTGGCGAGCACACTG] 3' and primer B 5' [tttttgaatagacccagtacctga] 3'. | |
Pattern | Adult Expression: pharynx; intestine; | ||
Larval Expression: pharynx; intestine; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC10021 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002024 |