WormBase Tree Display for Expr_pattern: Expr5463
expand all nodes | collapse all nodes | view schema
Expr5463 | Expression_of | Gene | WBGene00007993 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00007993 | ||||
Homol | Homol_homol | C37E2:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005735 | |||||
WBbt:0005738 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005813 | |||||
WBbt:0005828 | |||||
WBbt:0006748 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [C37E2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCACCGAGTAAAATACGCAA] 3' and primer B 5' [AGGATGCTGAAAACATTGGAGT] 3'. | |||
Pattern (2) | |||||
Remark | Also expressed in (comments from author) : Unidentified cells in head and around vulva. | ||||
Strain: BC11105 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002489 |