Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5459

expand all nodes | collapse all nodes | view schema

Name Class

Expr5459Expression_ofGeneWBGene00003242
Reflects_endogenous_expression_ofWBGene00003242
HomolHomol_homolCHROMOSOME_V:Expr
Expression_data (2)
TypeReporter_gene[C37C3.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
PatternAdult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; coelomocytes; unidentified cells in body ;
Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; coelomocytes; unidentified cells in body ;
RemarkStrain: BC11970
ReferenceWBPaper00006525
TransgeneWBTransgene00002771