Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5423

expand all nodes | collapse all nodes | view schema

Name Class

Expr5423Expression_ofGeneWBGene00016415
Reflects_endogenous_expression_ofWBGene00016415
HomolHomol_homolC34F11:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (18)
TypeReporter_gene[C34F11.3b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTTCACGCCTCACTCAG] 3' and primer B 5' [GTGTCTTCGGGATTCTTCCTATAA] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Picture (6)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC15498
ReferenceWBPaper00006525
TransgeneWBTransgene00003991