WormBase Tree Display for Expr_pattern: Expr5421
expand all nodes | collapse all nodes | view schema
Expr5421 | Expression_of | Gene | WBGene00000229 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000229 | ||
Homol | Homol_homol | C34E10:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'. | |
Pattern | Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; | ||
Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : Intense GFP expression made it hard to resolve some tissues. | ||
Strain: BC10161 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002116 |