WormBase Tree Display for Expr_pattern: Expr5412
expand all nodes | collapse all nodes | view schema
| Expr5412 | Expression_of | Gene | WBGene00016384 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00016384 | ||
| Homol | Homol_homol | CHROMOSOME_IV:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [C33H5.18a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGATTCAAAATAGGCTATCGAAAA] 3' and primer B 5' [GGTTGATCGGAGATCTGAAAAAT] 3'. | |
| Pattern | Adult Expression: pharynx; Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ; | ||
| Larval Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ; | |||
| Picture | WBPicture0000009293 | ||
| WBPicture0000009294 | |||
| WBPicture0000009295 | |||
| WBPicture0000009296 | |||
| Remark | Also expressed in (comments from author) : unidentified cells in head and around vulva.High intensity GFP.Mosaic population. | ||
| Strain: BC12993 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004378 |
